Lola - Documentation
(2005)
This is a little tutorial to get you started with LOLA. First you have to generate a sequence and an entry positions file (simple txt format). The sequence file contains the DNA sequence you want to analyze (only A,T,C,G allowed), the entry positions file is a list of the genome positions from where sequence fragments will be extracted (numbers, each followed by a return). Now, open LOLA and open your files as set A. In the Load files window you can choose if certain fragments shall be extracted reverse complementary. For instance if you analyze C-to-U RNA editing sites, you would tick the G-box.. If LOLA detects a G at a position it will treat the sequence as reverse complementary. If you want to compare your set A with another set of sequence fragments, tick the Set B field and open a second file set.
File Formats
Simple Text-files can be used for input:
| The Sequence-File: | The Positions-File |
| GACTTCTATCATCTTTCACTTCCACTCCCTATT CAGAATCATTCACAATTACATTTCAAGAGATTT GAAATGATAAATTTATTGAAATGAAATATATAA TAAATGATGGAAAGGTAAAATAATTTCAACTTA TTTTATCTTTTCATTGAAACTAATATAGAAGGT GAGAGGTAAGAAAAGTAAGAAGTATAGACACAA ATAATTACTTTACTTCTATATATATAGACATAC ATAATTACTCTAGTTTTACATAAAATTATTGGA GTAATGCCTTGATGGTGAAATGGTAGACACGTG AGACTCAAATCTCGTGCTGAAAAGCATGGAGGT CAATCCTCTTCAGGCATATTATAGGATTTTGTA TTACCAATATATAAAGTTAAAGAAATAAATAAA AAACTTACTTTCTAGGAAGAAAAATTAGAAAGA AAAAATTTTTCATATTTGTTCCTATTGCTTAAT CTTTATTTCTATGAAAATTGAAAGATTCTTCAA ACTAAGAAAGAGAAATAACAATTTAGTATAAAT AGATATATATATAAAGAATGATCTTGTGTTATA CTATTTCGTCGATATCGAAGAATTAACTAAATT |
899 904 3621 3724 3934 3939 4261 4366 4462 5077 5085 5109 5136 |
In the LOLA-Application, press 'open'
Select the files to load
Now you should see the sequence fragments extracted from the
sequence-file at the positions as specified in the positions-file.
Select two or more fragments by holding down the 'ctrl'-key and clicking on the list.
In the bottom-right-corner you can see a pairwise comparison between the selected sequence fragments
Sequence Extraction Parameters
- Upstream-Offset:
Nucleotides: Nucleotides upstream to extract (negative values possible)
Exclusion: Nucleotides upstream to be omitted from subsequent analysis (wont be deleted but not scored in comparisons)
- Downstream-Offset:
Nucleotides: Nucleotides to extract downstream (1 is the entry position, 2 is the entry position and the first nucleotide downstream; negative values possible)
Exclusion: Nucleotides downstream to be omitted from subsequent analysis (wont be deleted but not scored in comparisons)
- Distance-Method:
Elementwise: compares the fragments nucleotide per nucleotide
Edit-Distance: counts the minimal number of modifications (mutations, insertions or deletions) which are required to make the two sequences identical.
- Threshold: Elementwise: difference (0 = identical); Edit Distance: number of modification steps / length of fragment
Note: press Enter after changing a parameter
Then you can press 'compare' to compare all fragments pairwise.
If only Set A is activated, all fragments of Set A will be compared.
If Set B is activated, all fragments from Set A will be with all
Fragments from Set B. Dots in the output represent nucleotides
identical in both sequences. Note that insertions or deletions used
by the Edit-Distance mode are not displayed.
Example Compare
|
Distance-Method: Edit-Distance Offsets: ...10<-...[2<-..P..->1]...->10... Threshold=0.2 Comparing internally in Set A 1. 10065<->10066 =>0.17647058823529413 AGTGTCAG(ATT)TTTAGGGAC GTGTCAGA(T..)..AG..ACA 2. 13200<->71579 =>0.17647058823529413 TAAAGTTG(AGT)AATTATTAG .G....AC(.A.)......... 3. 14272<->14273 =>0.11764705882352941 AAGTGGAA(TCT)TAAAATGAA .GTG.A.T(CT.)A...TGA.. 4. 15419<->15420 =>0.17647058823529413 TATGTTTC(TTC)CCACTTTCG ATGT..CT(.C.).ACT..CGT 5. 15765<->130014 =>0.17647058823529413 ATGATGTT(TTC)AGGACTATT .....T..(...)....A..G. 6. 16799<->16800 =>0.17647058823529413 TTTTATTG(GAT)TTGGTGTTG ...AT.G.(AT.).G.TGT.G. 7. 16952<->16953 =>0.11764705882352941 TCTAGCAC(CTC)CATCTGCAA CTAGCAC.(TC.)ATCTGCA.. |
Window Scan
The Window Scan function runs a window of a size defined by your upstream and downstream values along all possible sequence pairs. After pressing Window-Scan you will be asked where the window should start and stop. The Window moves in one nucleotide steps and counts the number of sequence pairs which exceed the threshold at each position. This function can be used to detect if your sequence fragments contain sequence elements which occur at the same or similar position but are different in sequence for fragment subsets. Note: Window Scan works only for Set A. Note: if the graphical output window appears white enlarge it to full screen. Note: you can copy the values in the oputput windows to Excel to prepare a diagram on your own.
The result is a text-output containing a list of rows, each representing the compare-process for a combination of up-/down-stream-values and the number of pairs found which distance is lesser or equal to the threshold
Example WindowScan
|
|
DotEngine
The DotEngine visualizes the relationships between the sequence pairs which exceeded the threshold in your comparison. This can be used to identify subgroups of sequences which are similar to each other but different to the other sequences. Note: DotEngine works only for internal comparison in Set A.
Press the button 'DotEngine'.
All sequence fragments with a pairwise distance lesser or equal to the threshold-value will be added to the DotEngine-Graph and be arranged and colored according to their distances.
Similar sequence fragments will be drawn near to each other and have a similar color.
Use the mouse wheel to zoom in and out
Hold down the left mouse button and drag a rectangle to select sequence fragments.
If you move the mouse cursor over a selected sequence fragment its distances to every other selected sequence fragment will be shown:
You can also hold down the right mouse button on a sequence fragment and use the mouse wheel to select or deselect the most similar sequence fragment (still the Elementwise-/Edit-Distance):
